Skip to main content

Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer.

Publication ,  Journal Article
Yoon, SO; Chikaraishi, DM
Published in: J Biol Chem
July 15, 1994

The enhancer of the rat tyrosine hydroxylase gene (TH) in PC8b cells is composed of the AP1 motif (TCATTCA, -205 to -199) and an overlapping 20-base pair dyad symmetry element (TCAGAGGCAGGTGCCTGTGA, -201 to -182) whose core is an E-box. We have isolated two partial cDNA clones that encode factors which bind the TH-dyad. One is rITF2 with a basic helix-loop-helix motif and the other is CDP2 with a homeodomain. rITF2 is a rat homolog of human ITF2 (or E2-2), and CDP2 is a member of a new family of homeoproteins defined by histidine as the 9th residue of the recognition helix and by unique 64 amino acid repeats related to those of the Drosophila cut gene. The binding affinity of CDP2 alone is relatively weak, but it enhances the binding of rITF2 to the TH-dyad. In transfected F9 cells, activation of a TH-driven reporter requires both rITF2 and CDP2, suggesting that the proteins may functionally interact. However, rITF2 and CDP2 are not restricted to TH-expressing tissues; hence they may not be involved in the tissue-specific expression of TH. In addition, CDP2 is phosphorylated in vitro and in vivo.

Duke Scholars

Published In

J Biol Chem

ISSN

0021-9258

Publication Date

July 15, 1994

Volume

269

Issue

28

Start / End Page

18453 / 18462

Location

United States

Related Subject Headings

  • Tyrosine 3-Monooxygenase
  • Tumor Cells, Cultured
  • Transfection
  • Transcription Factors
  • Transcription Factor 7-Like 2 Protein
  • Transcription Factor 4
  • Trans-Activators
  • TCF Transcription Factors
  • Sequence Homology, Amino Acid
  • Rats
 

Citation

APA
Chicago
ICMJE
MLA
NLM
Yoon, S. O., & Chikaraishi, D. M. (1994). Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer. J Biol Chem, 269(28), 18453–18462.
Yoon, S. O., and D. M. Chikaraishi. “Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer.J Biol Chem 269, no. 28 (July 15, 1994): 18453–62.
Yoon SO, Chikaraishi DM. Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer. J Biol Chem. 1994 Jul 15;269(28):18453–62.
Yoon, S. O., and D. M. Chikaraishi. “Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer.J Biol Chem, vol. 269, no. 28, July 1994, pp. 18453–62.
Yoon SO, Chikaraishi DM. Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer. J Biol Chem. 1994 Jul 15;269(28):18453–18462.

Published In

J Biol Chem

ISSN

0021-9258

Publication Date

July 15, 1994

Volume

269

Issue

28

Start / End Page

18453 / 18462

Location

United States

Related Subject Headings

  • Tyrosine 3-Monooxygenase
  • Tumor Cells, Cultured
  • Transfection
  • Transcription Factors
  • Transcription Factor 7-Like 2 Protein
  • Transcription Factor 4
  • Trans-Activators
  • TCF Transcription Factors
  • Sequence Homology, Amino Acid
  • Rats