Tissue-specific transcription of the rat tyrosine hydroxylase gene requires synergy between an AP-1 motif and an overlapping E box-containing dyad.
Journal Article (Journal Article)
Transcription of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, is regulated in a tissue-specific manner. We have identified sequences from -205 to -182 as the minimal enhancer for TH in pheochromocytoma cells using site-directed mutagenesis. This segment (TGATTCAGAGGCAGGTGCCTGTGA) is composed of an AP-1 motif (TGATTCA) and an overlapping 20 bp dyad whose core resembles an E box site (CANNTG). Interaction between the two elements is necessary both in vivo and in vitro: mutation of either element caused a 65%-95% reduction in transcription, and the combination of the two elements conferred cell-specific activation on a heterologous promoter; separation of the two elements by an additional helical turn not only disrupted a DNA-protein complex unique to the two elements, but also abolished expression in vivo. Therefore, we conclude that the interaction between the AP-1 and the E box dyad motifs is responsible for cell-specific TH expression.
Full Text
Duke Authors
Cited Authors
- Yoon, SO; Chikaraishi, DM
Published Date
- July 1992
Published In
Volume / Issue
- 9 / 1
Start / End Page
- 55 - 67
PubMed ID
- 1352985
International Standard Serial Number (ISSN)
- 0896-6273
Digital Object Identifier (DOI)
- 10.1016/0896-6273(92)90220-8
Language
- eng
Conference Location
- United States