Quadruplex DNA formation in a region of the tRNA gene supF associated with hydrogen peroxide mediated mutations.

A hot spot for H2O2/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189 [Moraes et al. (1990) Carcinogenesis 11, 283; Akman et al. (1991) Mutat. Res. (in press)]. To further characterize this hot spot, we synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed spontaneously in 10 mM Tris-HCl (pH 8.0)-1 mM EDTA-100 mM NaCl at 50 degrees C into two major forms, one of which migrates more slowly than does d(pT)33 on nondenaturing 12% polyacrylamide gels. We propose that this form is a four-stranded structure stabilized by Hoogsteen-type deoxyguanosine quartets involving all deoxyguanosines of the sequence d-(pGGTGGTGGGGG) because of the following. (1) pZ33 migrates as a single form that comigrates with d(pT)33 on denaturing 20% acrylamide-8 M urea gels. (2) Annealing an equimolar mixture of 5'-32P-labeled pZ33 and the oligodeoxynucleotide d(pTTTTTTTTpZ33TTTTTTTT) (pZ49), as well as 5'-32P-labeled pZ49 and pZ33, caused the formation of four, discreet slowly migrating bands on nondenaturing 12% polyacrylamide gels. Mixing 5'-32P-labeled pZ33 with 5'-32P-labeled pZ49 resulted in five slowly migrating bands. (3) An oligodeoxynucleotide identical with pZ33 except that every deoxyguanosine has been replaced with deoxyinosine did not anneal into a slowly migrating form. (4) Dimethyl sulfate protection studies demonstrated that all deoxyguanosines of the sequence d(pGGTGGTGGGGG) were protected at N-7 in the slowly migrating form but not in single-stranded pZ33. These data suggest that a hot spot for H2O2/Fe-mediated base substitutions is located adjacent to a sequence that can spontaneously adopt a quadruplex structure in which deoxyguanosine quartets are Hoogsteen bonded.

Duke Scholars

Author Steven Alan Akman Medicine, Medical Oncology