Scholars@Duke
Dona M. Chikaraishi

Dona M. Chikaraishi

Professor Emeritus of Neurobiology
Neurobiology
donam@neuro.duke.edu
Box 103855 Med Ctr, Durham, NC 27710
2034 GSRB 1, 905 LaSalle, Durham, NC 27710

Selected Publications

High oxygen prevents fetal lethality due to lack of catecholamines.

Journal Article Am J Physiol Regul Integr Comp Physiol · September 2008 The catecholamine norepinephrine is required for fetal survival, but its essential function is unknown. When catecholamine-deficient [tyrosine hydroxylase (Th) null] mouse fetuses die at embryonic day (E)13.5-14.5, they resemble wild-type (wt) fetuses expo ... Full text Link to item Cite

Early fetal hypoxia leads to growth restriction and myocardial thinning.

Journal Article Am J Physiol Regul Integr Comp Physiol · August 2008 Hypoxia is necessary for fetal development; however, excess hypoxia is detrimental. Hypoxia has been extensively studied in the near-term fetus, but less is known about earlier fetal effects. The purpose of this study was to determine the window of vulnera ... Full text Link to item Cite

A tyrosine hydroxylase-yellow fluorescent protein knock-in reporter system labeling dopaminergic neurons reveals potential regulatory role for the first intron of the rodent tyrosine hydroxylase gene.

Journal Article Neuroscience · October 13, 2006 Degeneration of the dopaminergic neurons of the substantia nigra is a hallmark of Parkinson's disease. To facilitate the study of the differentiation and maintenance of this population of dopaminergic neurons both in vivo and in vitro, we generated a knock ... Full text Link to item Cite

Beta1-adrenergic receptors maintain fetal heart rate and survival.

Journal Article Biol Neonate · 2006 Beta-adrenergic receptor (betaAR) activation has been shown to maintain heart rate during hypoxia and to rescue the fetus from the fetal lethality that occurs in the absence of norepinephrine. This study examines whether the same subtype of betaAR is respo ... Full text Link to item Cite

Induction of tyrosine hydroxylase in the locus coeruleus of transgenic mice in response to stress or nicotine treatment: lack of activation of tyrosine hydroxylase promoter activity.

Journal Article J Neurochem · August 2005 Prolonged stress or chronic nicotine administration leads to induction of tyrosine hydroxylase (TH) in adrenal medulla and locus coeruleus (LC) of the rat. In this study we use mice that express a transgene encoding 4.5 kb of TH gene 5'-flanking region fus ... Full text Link to item Cite

Olfactory receptor gene expression in tiger salamander olfactory epithelium.

Journal Article J Comp Neurol · June 28, 2004 Physiological studies of odor-elicited responses from the olfactory epithelium and bulb in the tiger salamander, Ambystoma tigrinum, have elucidated a number of features of olfactory coding that appear to be conserved across several vertebrate species. Thi ... Full text Link to item Cite

Tyrosine hydroxylase transcription depends primarily on cAMP response element activity, regardless of the type of inducing stimulus.

Journal Article Mol Cell Neurosci · March 2004 In neurons and neuroendocrine cells, tyrosine hydroxylase (TH) gene expression is induced by stimuli that elevate cAMP, by depolarization, and by hypoxia. Using these stimuli, we examined TH promoter mutants, cAMP response element binding protein (CREB) ph ... Full text Link to item Cite

Catecholamines act via a beta-adrenergic receptor to maintain fetal heart rate and survival.

Journal Article Am J Physiol Heart Circ Physiol · June 2003 Featured Publication Mice lacking catecholamines die before birth, some with cardiovascular abnormalities. To investigate the role of catecholamines in development, embryonic day 12.5 (E12.5) fetuses were cultured and heart rate monitored. Under optimal oxygenation, wild-type ... Full text Link to item Cite

Neurotrophin-3 mediates the autocrine survival of the catecholaminergic CAD CNS neuronal cell line.

Journal Article J Neurochem · January 2001 The mechanisms for neuronal survival in the CNS are not well understood, but are likely to be complex due to possible autocrine and redundant neurotrophic support. Most studies have focused on the nerve growth factor (NGF)/TrkA pathway in peripheral neuron ... Full text Link to item Cite

4.5 kb of the rat tyrosine hydroxylase 5' flanking sequence directs tissue specific expression during development and contains consensus sites for multiple transcription factors.

Journal Article Brain Res Mol Brain Res · December 10, 1999 To delineate DNA sequences responsible for developmentally correct expression of the rat tyrosine hydroxylase (TH) gene, we analyzed a line of transgenic mice expressing high levels of human placental alkaline phosphatase (AP) under control of 4.5 kb of 5' ... Full text Link to item Cite

Catecholamine synthesis is mediated by tyrosinase in the absence of tyrosine hydroxylase.

Journal Article J Neurosci · May 1, 1999 Catecholamine neurotransmitters are synthesized by hydroxylation of tyrosine to L-dihydroxyphenylalanine (L-Dopa) by tyrosine hydroxylase (TH). The elimination of TH in both pigmented and albino mice described here, like pigmented TH-null mice reported pre ... Full text Link to item Cite

Differentiation of a catecholaminergic CNS cell line modifies tyrosine hydroxylase transcriptional regulation.

Journal Article J Neurochem · July 1998 Recently, a tyrosine hydroxylase (TH)-expressing CNS-derived cell line, CAD, was obtained that is capable of undergoing reversible morphological differentiation. The isolation of the CAD line allowed us to ask whether different DNA regulatory elements dire ... Full text Link to item Cite

Expression of non-N-methyl-D-aspartate glutamate receptor subunits in the olfactory epithelium.

Journal Article Neuroscience · July 1997 The channel properties of the multimeric ionotropic glutamate receptors can be regulated by their subunit composition. The relationship between the structure and physiological functions of glutamate receptors, however, is difficult to study in the CNS beca ... Full text Link to item Cite

A novel basal promoter element is required for expression of the rat tyrosine hydroxylase gene.

Journal Article J Neurosci · June 1, 1997 Transcription of the rat tyrosine hydroxylase (TH) gene is controlled by enhancer sequences in its 5' flanking region; these enhancers include the AP1, dyad, and cAMP response element (CRE) motifs. We show that a novel basal promoter element (-17 GCCTGCCTG ... Full text Link to item Cite

Induction of tyrosine hydroxylase protein and a transgene containing tyrosine hydroxylase 5' flanking sequences by stress in mouse adrenal gland.

Journal Article J Neurochem · March 1997 Prolonged stress is associated with the induction of tyrosine hydroxylase (TH) gene expression in rat adrenal medulla. We have used transgenic mice expressing a transgene encoding 4.5 kb of rat TH gene 5' flanking region fused upstream of the structural ge ... Full text Link to item Cite

Characterization of a CNS cell line, CAD, in which morphological differentiation is initiated by serum deprivation.

Journal Article J Neurosci · February 15, 1997 A CNS catecholaminergic cell line, Cath.a, was established by targeted oncogenesis in transgenic mice. Cath.a cells express neuronal properties but lack neuronal morphology. Here, we describe a variant of Cath.a, called CAD (Cath.a-differentiated), in whic ... Full text Link to item Cite

A CNS catecholaminergic cell line expresses voltage-gated currents.

Journal Article J Membr Biol · June 1996 CATH.a is a central nervous system (CNS) catecholaminergic cell line derived from a transgenic mouse carrying the SV40 T antigen oncogene under the transcriptional control of regulatory elements from the rat tyrosine hydroxylase gene (Suri et al., 1993). C ... Full text Link to item Cite

The cyclic AMP response element directs tyrosine hydroxylase expression in catecholaminergic central and peripheral nervous system cell lines from transgenic mice.

Journal Article J Biol Chem · September 15, 1995 Enhancer elements regulating the neuronal gene, tyrosine hydroxylase (TH), were identified in TH-expressing peripheral nervous system PATH and central nervous system CATH cell lines. Mutational analysis in which rat TH 5'-flanking sequences directed chlora ... Full text Link to item Cite

Autofeedback suppression of growth hormone (GH) secretion in transgenic mice expressing a human GH reporter targeted by tyrosine hydroxylase 5'-flanking sequences to the hypothalamus.

Journal Article Endocrinology · September 1995 Transgenic mice expressing a tyrosine hydroxylase-human (h) GH fusion gene in the hypothalamus exhibit a dwarf phenotype. The GH feedback mechanism(s) underlying the growth retardation in these animals was investigated by assessing peptide and messenger RN ... Full text Link to item Cite

Olfactory marker protein mRNA is found in axons of olfactory receptor neurons.

Journal Article J Neurosci · July 1995 The separation between the cell bodies of olfactory receptor neurons in the nasal cavity and their axon terminals in the olfactory bulb make them attractive for studying axonal transport. Although high molecular weight RNAs are generally believed to be exc ... Full text Link to item Cite

Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer.

Journal Article J Biol Chem · July 15, 1994 The enhancer of the rat tyrosine hydroxylase gene (TH) in PC8b cells is composed of the AP1 motif (TCATTCA, -205 to -199) and an overlapping 20-base pair dyad symmetry element (TCAGAGGCAGGTGCCTGTGA, -201 to -182) whose core is an E-box. We have isolated tw ... Link to item Cite

DNA regulatory sequences of the rat tyrosine hydroxylase gene direct correct catecholaminergic cell-type specificity of a human growth hormone reporter in the CNS of transgenic mice causing a dwarf phenotype.

Journal Article Brain Res Mol Brain Res · July 1994 Transgenic mice bearing 4.8 kilobases (kb) of upstream rat tyrosine hydroxylase (TH) sequences linked to a human growth hormone gene (hGH) exhibited cell-specific expression of hGH in all the appropriate catecholaminergic neurons in the central nervous sys ... Full text Link to item Cite

The Oct-2 transcription factor represses tyrosine hydroxylase expression via a heptamer TAATGARAT-like motif in the gene promoter.

Journal Article Nucleic Acids Res · March 25, 1994 The tyrosine hydroxylase (TH) gene promoter contains adjacent octamer and heptamer motifs which act as target sites for octamer binding transcription factors. Mutation of the heptamer motif but not the octamer motif enhances TH promoter activity in neurona ... Full text Link to item Cite

Molecular phenotype of simian virus 40 large T antigen-induced primitive neuroectodermal tumors in four different lines of transgenic mice.

Journal Article Lab Invest · January 1994 BACKGROUND: We compared the molecular phenotypes of central nervous system tumors arising in four different lines of transgenic mice (TGM) carrying the Simian virus 40 large T antigen driven by different promoters or enhancers. Two of the four lines develo ... Link to item Cite

TYROSINE-HYDROXYLASE REGULATION IN CULTURED-CELLS AND IN MICE

Journal Article JOURNAL OF NEUROCHEMISTRY · January 1, 1994 Link to item Cite

Catecholaminergic cell lines from the brain and adrenal glands of tyrosine hydroxylase-SV40 T antigen transgenic mice.

Journal Article J Neurosci · March 1993 Brain (CATH.a) and adrenal (PATH.1 and PATH.2) cell lines have been established that synthesize abundant dopamine and norepinephrine and express the appropriate catecholaminergic biosynthetic enzymes, tyrosine hydroxylase (TH) and dopamine beta-hydroxylase ... Full text Link to item Cite

5' flanking sequences of the rat tyrosine hydroxylase gene target accurate tissue-specific, developmental, and transsynaptic expression in transgenic mice.

Journal Article J Neurosci · November 1992 Transgenic mice were generated in which sequences that flank the rat tyrosine hydroxylase (TH) gene were linked to the bacterial chloramphenicol acetyl transferase (CAT) gene. Mice bearing 4.8 kilobases (kb) of 5' flanking DNA exhibited correct tissue-spec ... Full text Link to item Cite

Tissue-specific transcription of the rat tyrosine hydroxylase gene requires synergy between an AP-1 motif and an overlapping E box-containing dyad.

Journal Article Neuron · July 1992 Transcription of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, is regulated in a tissue-specific manner. We have identified sequences from -205 to -182 as the minimal enhancer for TH in pheochromocytoma cells using site ... Full text Link to item Cite

Sequences that direct rat tyrosine hydroxylase gene expression.

Journal Article J Neurochem · June 1992 Investigation of neuroendocrine genes has revealed that transcription is regulated via multiple DNA binding sites, including the cyclic AMP response element (CRE). We show here that for the neuronal and chromaffin-specific gene tyrosine hydroxylase (TH), a ... Full text Link to item Cite

Characterization of potential precursor populations in the mouse olfactory epithelium using immunocytochemistry and autoradiography.

Journal Article J Neurosci · November 1991 There are at least two basal cell populations in the olfactory epithelium that could give rise to olfactory neurons during development, in the normal adult, and after experimentally induced receptor cell death. These populations have been subdivided as hor ... Full text Link to item Cite

Brain-specific polyA- transcripts are detected in polyA+ RNA: do complex polyA- brain RNAs really exist?

Journal Article J Neurosci · March 1991 Transcripts encoded by 2 different rat genomic clones, rg13 and rg100, appear to be typical brain-specific polyA- RNAs, as defined by previous criteria (rare, polysomal, and postnatally expressed from single-copy genes). However, we have found by using a s ... Full text Link to item Cite

Regulation of neurogenesis and neuronal differentiation in primary and immortalized cells from mouse olfactory epithelium.

Journal Article Ciba Found Symp · 1991 We have developed an in vitro system for studying molecular events regulating neurogenesis in the mouse olfactory epithelium (OE). Our observations suggest that two types of neuronal precursor may be involved: (1) a transiently existing, immediate neuronal ... Full text Link to item Cite

Differential expression of ros oncogene in primary human astrocytomas and astrocytoma cell lines.

Journal Article Cancer Res · May 15, 1990 Overexpression of oncogenes has been associated with the pathogenesis of some human cancers. The ros oncogene, which encodes a putative receptor with tyrosine kinase activity, has been recently shown to be specifically expressed in high levels in human ast ... Link to item Cite

Steroid hormone regulation of ribosomal RNA in rat hypothalamus: early detection using in situ hybridization and precursor-product ribosomal DNA probes.

Journal Article J Neurosci · May 1990 In the female rat, behavioral and endocrine aspects of reproduction are controlled, in part, by the action of the steroid hormone estradiol on several regions of the brain, including the ventrolateral portion of the ventromedial hypothalamus (VL-VMN) and t ... Full text Link to item Cite

5' flanking DNA sequences direct cell-specific expression of rat tyrosine hydroxylase.

Journal Article J Neurochem · November 1989 Tyrosine hydroxylase (TH) is selectively expressed in catecholaminergic neurons and in chromaffin cells of the adrenal medulla. Constructs in which 5' flanking sequences of the rat TH gene directed expression of bacterial chloramphenicol acetyltransferase ... Full text Link to item Cite

Tyrosine hydroxylase mRNA in the neurons of the tuberoinfundibular region and zona incerta examined after gonadal steroid hormone treatment.

Journal Article Mol Endocrinol · September 1989 The dopamine-producing neurons of the tuberoinfundibular region are known targets of estrogen and progesterone, and are of considerable neuroendocrine importance. To determine the anatomical distribution, and number of cells that contain tyrosine hydroxyla ... Full text Link to item Cite

Analysis of neurogenesis in a mammalian neuroepithelium: proliferation and differentiation of an olfactory neuron precursor in vitro.

Journal Article Neuron · July 1989 Development of a culture system for mammalian olfactory epithelium has permitted the process of neurogenesis to be examined in vitro. Antibody markers allowing the unambiguous identification of putative neuroepithelial stem cells (keratin+ basal cells) and ... Full text Link to item Cite

In situ hybridization analysis of osmotic stimulus-induced changes in ribosomal RNA in rat supraoptic nucleus.

Journal Article J Comp Neurol · April 22, 1988 A quantitative in situ hybridization analysis was used to investigate changes in levels of ribosomal RNA (rRNA) in neurons of the supraoptic nucleus (SON) of rats stimulated osmotically by giving 2% NaCl as drinking solution for 0 (control rats), 1, 4, and ... Full text Link to item Cite

Increases in ribosomal RNA within the denervated neuropil of the dentate gyrus during reinnervation: evaluation by in situ hybridization using DNA probes complementary to ribosomal RNA.

Journal Article Brain Res · September 1987 Previous studies have revealed that there are increases in the incorporation of [3H]amino acids into protein in the denervated neuropil of the dentate gyrus during periods of reactive synaptogenesis. The present study evaluates whether the increase in inco ... Full text Link to item Cite

Regulated expression of the tyrosine hydroxylase gene by epidermal growth factor.

Journal Article Mol Cell Biol · September 1987 The addition of epidermal growth factor (EGF) to cultures of the rat PCG2 pheochromocytoma cell line increased the level of RNA coding for tyrosine hydroxylase (TH). A region of DNA containing 5'-flanking sequences of the TH gene was fused to a heterologou ... Full text Link to item Cite

Transcriptional regulation of the tyrosine hydroxylase gene by glucocorticoid and cyclic AMP.

Journal Article Proc Natl Acad Sci U S A · June 1987 Glucocorticoid and cyclic AMP increase tyrosine hydroxylase (TH) activity and mRNA levels in pheochromocytoma cultures. The transcriptional activity of the TH gene, as measured by nuclear run-on assay, is also increased when cultures are treated with the s ... Full text Link to item Cite

Identification and cell type specificity of the tyrosine hydroxylase gene promoter.

Journal Article Nucleic Acids Res · March 11, 1987 Genomic DNA encoding the rat tyrosine hydroxylase (TH) gene was isolated from a lambda phage library using a nick-translated fragment from a cDNA clone for rat TH. We have determined the initiation site for TH RNA synthesis and have sequenced 1100 bases of ... Full text Link to item Cite

Transcription of spacer sequences flanking the rat 45S ribosomal DNA gene.

Journal Article Mol Cell Biol · January 1987 The transcriptional activity of spacer sequences flanking the rat 45S ribosomal DNA (rDNA) gene were studied. Nascent RNA labeled in in vitro nuclear run-on reactions hybridized with both 5' and 3' spacer regions. The highest level of hybridization was see ... Full text Link to item Cite

In situ hybridization detection of estradiol-induced changes in ribosomal RNA levels in rat brain.

Journal Article Brain Res · November 1986 In this study, quantitative assessment of estradiol (E2)-induced changes in levels of ribosomal RNA within brain regions concentrating the hormone was accomplished by in situ hybridization with nick-translated tritiated ribosomal DNA probes and use of a co ... Full text Link to item Cite

The ID, brain identifier, model of neuronal gene expression: a re-evaluation

Journal Article Trends in Neurosciences · January 1, 1986 Full text Cite

RARE NONPOLYADENYLATED TRANSCRIPTS UNIQUE TO RAT-BRAIN

Journal Article JOURNAL OF CELLULAR BIOCHEMISTRY · January 1, 1986 Link to item Cite

Elevation of RNA coding for tyrosine hydroxylase in rat adrenal gland by reserpine treatment and exposure to cold.

Journal Article J Neurochem · October 1985 When rats are treated daily with reserpine or maintained at 4 degrees C, the level of a specific RNA coding for tyrosine hydroxylase is elevated in the adrenal gland. The increase in this specific RNA temporally precedes and is quantitatively equal to the ... Full text Link to item Cite

Trans-synaptic increase in RNA coding for tyrosine hydroxylase in a rat sympathetic ganglion.

Journal Article Brain Res · July 22, 1985 To begin examining molecular mechanisms underlying trans-synaptic regulation, tyrosine hydroxylase (TH) and its messenger RNA (mRNA) were examined in the superior cervical sympathetic ganglion (SCG) of adult rats. Basal levels of TH mRNA were detectable in ... Full text Link to item Cite

Cloning of DNA corresponding to rare transcripts of rat brain: evidence of transcriptional and post-transcriptional control and of the existence of nonpolyadenylated transcripts.

Journal Article Mol Cell Biol · October 1984 To examine the expression of genes encoding rare transcripts in the rat brain, we have characterized genomic DNA clones corresponding to this class. In brain cells, as in all cell types, rare transcripts constitute the majority of different sequences trans ... Full text Link to item Cite

Isolation of a cDNA clone complementary to sequences for a 34-kilodalton protein which is a pp60v-src substrate.

Journal Article Mol Cell Biol · September 1984 We have isolated a partial cDNA clone containing sequences complementary to a mRNA encoding a 34- to 36-kilodalton normal chicken cell protein which is a substrate for pp60v-src kinase activity. Using this 34-kilodalton cDNA clone as a probe, we determined ... Full text Link to item Cite

Regulation of tyrosine hydroxylase mRNA by glucocorticoid and cyclic AMP in a rat pheochromocytoma cell line. Isolation of a cDNA clone for tyrosine hydroxylase mRNA.

Journal Article J Biol Chem · December 10, 1983 Treatment of a subclone of the PC12 pheochromocytoma cell line, PC8b, with either dexamethasone or 8-bromo cyclic AMP resulted in increased translational activity of tyrosine hydroxylase mRNA (mRNATH). Poly(A+)-containing RNA from cells treated with both i ... Link to item Cite

Regulation of tyrosine hydroxylase mRNA by glucocorticoid and cyclic AMP in a rat pheochromocytoma cell line. Isolation of a cDNA clone for tyrosine hydroxylase mRNA.

Journal Article The Journal of biological chemistry · December 1983 Treatment of a subclone of the PC12 pheochromocytoma cell line, PC8b, with either dexamethasone or 8-bromo cyclic AMP resulted in increased translational activity of tyrosine hydroxylase mRNA (mRNATH). Poly(A+)-containing RNA from cells treated with both i ... Full text Cite

Genomic organization of rat rDNA.

Journal Article Nucleic Acids Res · September 24, 1983 A detailed restriction map was determined for a 10.9 KB region that contains the initiation site for 45S pre-rRNA and the first 1.7 KB of the 18S rRNA coding region. When the restriction pattern of the cloned rDNA was compared with that of total rat DNA, t ... Full text Link to item Cite

Identification and sequence of the initiation site for rat 45S ribosomal RNA synthesis.

Journal Article Nucleic Acids Res · May 25, 1983 The transcription initiation site for rat 45S precursor ribosomal RNA synthesis was determined by nuclease protection mapping with two single-strand endonucleases. S1 and mung bean, and one single-strand exonuclease, ExoVII. These experiments were performe ... Full text Link to item Cite

Simian virus 40 transcriptional complexes incorporate mercurated nucleotides into RNA in vitro.

Journal Article J Virol · January 1981 Simian virus 40 Sarkosyl transcriptional complexes incorporated mercurated nucleotide precursors into preinitiated RNA chains. Synthesis with mercurated precursors was three- to fivefold slower than with nonmercurated nucleotides (12 to 20 pmol per 10(6) c ... Full text Link to item Cite