Blocking Complement-Mediated Hemolysis of PNH Erythrocytes by RNA Aptamers to C8 and C9.
Nishimura, J-I; Nimjee, S; Jiang, H; Kawaguchi, T; Nakakuma, H; Omine, M; Frank, MM; Ware, RE; Sullenger, BA
Published in: Blood
Paroxysmal nocturnal hemoglobinuria (PNH) is an acquired hematopoietic stem cell disorder characterized by intravascular hemolysis, venous thrombosis, and bone marrow failure. The lack of GPI-anchored complement regulatory proteins, such as CD55 (DAF) but especially CD59 (MIRL), results in complement-mediated hemolysis and hemoglobinuria, which are major clinical manifestations of PNH and an important cause of morbidity and mortality. Recent results from a pilot study in patients with PNH, using a humanized monoclonal antibody (eculizumab) that binds to human complement C5 and inhibits terminal complement activation, suggested that blocking complement activation is a new potential therapeutic option for PNH that could control hemolysis, reduce transfusion dependency, and possibly reduce the risk of thrombosis (N Engl J Med, 350:552, 2004). RNA aptamer inhibitors of human complement protein C5 have already been identified using a combinatorial RNA library and an in vitro selection method (SELEX) (Immunopharmacology, 42:219, 1999). We previously synthesized a known C5-binding aptamer (TCTCATGCGCCGAGTGTGAGTTTACCTTCGT) and found that it inhibited human serum hemolytic activity (Blood, 102:510a, 2003). However, since C5 is critical not only for complement activation, but also for proper regulation of inflammatory processes, prolonged C5 inhibition could have undesired side effects that would limit its utility in PNH. Terminal complement proteins C8 and C9 represent potentially better targets, since CD59 inhibits C9 binding to the C5b8 complex, and is critically important in protecting erythrocytes from complement-mediated lysis. Individuals deficient in C9 are usually healthy, although inherited deficiencies in other complement proteins typically lead to various degrees of illness. Thus, C8 or C9 may be the ideal targets to protect PNH erythrocytes from complement-mediated lysis without adverse side effects. Using the SELEX procedure against purified C8 and C9 proteins, high affinity, nuclease-resistant RNA ligands were identified that bind specifically to C8 or C9. After 6 rounds of SELEX, C8 aptamers bound C8 with a Kd of 1 nM and a Bmax of 83%, and inhibited human serum hemolytic activity similar to or greater than C5 aptamers. After 16 rounds of SELEX, C9 aptamers bound C9 with a Kd of 12 nM and a Bmax of 58%, and also inhibited human serum hemolytic activity similar to or greater than C5 aptamers. C8 aptamers after 6 rounds, and C9 aptamers after 16 rounds, of SELEX have been cloned, sequenced, and categorized. All ten C8 aptamer clones had a similar sequence, while nine C9 aptamer clones had two families of similar sequences (n=5 and n=3, respectively). These clones are currently been synthesized for testing in both the binding and hemolytic inhibition assays. Selected high-affinity and high inhibitory aptamers will be modified in preparation for future in vivo studies in PNH. The development of blocking RNA aptamers, using the SELEX procedure against terminal complement proteins C8 and C9, represents a novel potential therapeutic option for patients with PNH.
Altmetric Attention Stats
Dimensions Citation Stats